Antisense oligonucleotide for treatment of neovascular glaucoma

What is neovascular glaucoma?

Glaucoma refers to certain eye diseases that affect the nerve of the eye and can cause vision loss. Most of these diseases typically produce gradual increase of the pressure in the eye leading to the injury of the nerve. In neovascular glaucoma the normal drainage canals within the eye are physically blocked by growth of new vessels. Diabetes, too high blood pressure, an excess of cholesterol in the blood and the presence of elements obstructing some vessels, represent significant risk factors for the development of neovascular glaucoma.

The condition is chronically debilitating, in particular due to uncontrolled high pressure inside the eye and loss of vision.

What are the methods of treatment available?

At the time of submission of the application for orphan drug designation, the treatment of neovascular glaucoma consisted of various surgical procedures and authorised medicines. Satisfactory argumentation has been submitted by the sponsor to justify the assumption that their medicinal product might be of potential significant benefit for the treatment of neovascular glaucoma. The assumption will have to be confirmed at the time of marketing authorisation. This will be necessary to maintain the orphan status.

What is the estimated number of patients affected by the condition?

According to the information provided by the sponsor, neovascular glaucoma was considered to affect about 75,000 to 113,000 persons in the European Union. How is this medicinal product expected to act? The medicinal product is a very short fragment of genetic code (DNA), which specifically blocks the production of a protein directly involved in the vessel growth stimulation. Thus once administered on the eye the medicinal product is intended to locally prevent the growth of new blood vessels.

Whis the stage of development of this medicinal product?

The effects of antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) were evaluated in experimental models. At the time of submission of the application for orphan designation, no clinical trials in patients with neovascular glaucoma were initiated.

The medicinal product was not marketed anywhere worldwide for neovascular glaucoma or designated as orphan medicinal product elsewhere for this condition, at the time of submission. According to Regulation (EC) No 141/2000 of 16 December 1999, the Committee for Orphan Medicinal Products (COMP) adopted on 30 July 2003 a positive opinion recommending the grant of the above-mentioned designation.

New Glaucoma Treatments

Sixty-seven-million people around the world cannot see because they suffer from the disease glaucoma.

The disease prevents the clear fluid in the eye from flowing normally. This causes increased fluid pressure inside the eye. The increased pressure can damage the optic nerve that carries images from the eye to the brain.

The most common kind of glaucoma mainly affects people over forty years old.People with family members who have the disease are more likely to develop glaucoma. Black people also are at higher risk for the disease. Others at high risk include people suffering from diabetes or high blood pressure.

The first sign of glaucoma is usually a very small loss of sight at the outside edges of the eye. Experts say most people do not know they have glaucoma until it causes a real loss of sight. Vision already lost to the disease cannot be restored.

However, the damage can be controlled and eyesight can be saved if the disease is discovered early. Doctors treat glaucoma with eye medicines or a laser light operation.

The United States Food and Drug Administration approved three new drugs last year to treat glaucoma. Two of these drugs increase the movement of fluid out of the eye. This reduces pressure in the eye. The third drug increases fluid drainage and also decreases the amount of fluid that is produced.

Researchers in Israel are developing a vaccine to treat glaucoma. Michal [me-KHAL] Schwartz is a professor at the Weizmann [VITES-mahn] Institute of Science in Rehovot [re -HO-vote]. She says tests on rats have shown that the drug Copaxone protects the optic nerve. The researchers may begin testing the vaccine in people in the next year or two. The Israeli researchers had developed Copaxone to treat the disease multiple sclerosis.

A Canadian researcher has created a device that permits people to measure their eye pressure at home. The device measures the pressure through the eyelid. Until now, measuring eye pressure could be done only at a doctor’s office. Experts say the new device will give glaucoma patients and their doctors better information about how drugs are working to control the pressure.

They also say that everyone over the age of forty should be tested for glaucoma by an eye doctor every year.

Study Finds Genetic Key to a Form of Glaucoma

Researchers in Iceland and Sweden have discovered genetic flaws that underlie pseudoexfoliative glaucoma, a form of glaucoma common in those of Scandinavian descent. Their finding may provide a basis for devising new treatments.

The finding is part of a continuing wave of discoveries about the genes underlying common diseases that began earlier this year as researchers reported the first results using a new device — DNA-scanning chips containing information on up to 500,000 genetically variable sites across the human genome.

By comparing the genomes of patients with those of people in good health, researchers can identify which of the variable sites are associated with the disease and so locate the causative genes. In the last few months, studies using whole genome association have identified genes or genetic elements involved in at least 10 major diseases.

The finding on glaucoma, reported last month in the journal Science, is from researchers at the National University Hospital in Reykjavik, Iceland, and Uppsala University in Sweden. By studying 16,000 patients in Iceland and Sweden, the researchers have identified two variant sites on the genome that indicate risk for exfoliative glaucoma. This form of glaucoma can occur when fibers of connective tissue break off into the fluid-filled front chamber of the eye and block the drainage channels through which the fluid circulates, resulting in damage to the optic nerve.

Paul R. Lichter, MD, director of the Kellogg Eye Center at the University of Michigan, called the research “very impressive.” If patients with higher genetic risk could be identified with a simple diagnostic test, “maybe we would look at those patients more carefully,” he said.

Source: The New York Times