What is neovascular glaucoma?
Glaucoma refers to certain eye diseases that affect the nerve of the eye and can cause vision loss. Most of these diseases typically produce gradual increase of the pressure in the eye leading to the injury of the nerve. In neovascular glaucoma the normal drainage canals within the eye are physically blocked by growth of new vessels. Diabetes, too high blood pressure, an excess of cholesterol in the blood and the presence of elements obstructing some vessels, represent significant risk factors for the development of neovascular glaucoma.
The condition is chronically debilitating, in particular due to uncontrolled high pressure inside the eye and loss of vision.
What are the methods of treatment available?
At the time of submission of the application for orphan drug designation, the treatment of neovascular glaucoma consisted of various surgical procedures and authorised medicines. Satisfactory argumentation has been submitted by the sponsor to justify the assumption that their medicinal product might be of potential significant benefit for the treatment of neovascular glaucoma. The assumption will have to be confirmed at the time of marketing authorisation. This will be necessary to maintain the orphan status.
What is the estimated number of patients affected by the condition?
According to the information provided by the sponsor, neovascular glaucoma was considered to affect about 75,000 to 113,000 persons in the European Union. How is this medicinal product expected to act? The medicinal product is a very short fragment of genetic code (DNA), which specifically blocks the production of a protein directly involved in the vessel growth stimulation. Thus once administered on the eye the medicinal product is intended to locally prevent the growth of new blood vessels.
Whis the stage of development of this medicinal product?
The effects of antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) were evaluated in experimental models. At the time of submission of the application for orphan designation, no clinical trials in patients with neovascular glaucoma were initiated.
The medicinal product was not marketed anywhere worldwide for neovascular glaucoma or designated as orphan medicinal product elsewhere for this condition, at the time of submission. According to Regulation (EC) No 141/2000 of 16 December 1999, the Committee for Orphan Medicinal Products (COMP) adopted on 30 July 2003 a positive opinion recommending the grant of the above-mentioned designation.
