Wednesday, June 17, 2009

GLAUCOMA SCREENING SERVICES COVERAGE ISSUE


Effective January 1, 2002, Medicare will provide coverage for an annual glaucoma screening for eligible Medicare beneficiaries, such as those with diabetes mellitus or a family history of glaucoma and African Americans aged 50 and older.

In addition, beginning with dates of service on or after January 1, 2006, 42 CFR 410.23(a)(2),revised, the definition of an eligible beneficiary in a high-risk category is expanded to included:

Ø Hispanic-Americans age 65 and over

CONDITION OF COVERAGE

For coverage to be considered, the screening examination must be furnished by or under direct supervision in the office setting of an ophthalmologist or optometrist, who is legally authorized to perform the services under State law.

Screening for glaucoma is defined to include

· A dilated eye examination with an intraocular pressure measurement; and

· A direct ophthalmoscopy examination, or a slit-lamp biomicroscopic examination.

In the past, it was thought that a high IOP measurement indicated glaucoma, and an IOP measurement using non-contact tonometry (more commonly known as the “air puff test”) alone was commonly used to diagnose glaucoma.

Health care professionals now know that glaucoma can be present with or without high IOP, which makes the examination of the eye and optic nerve (along with the IOP measurement) a critical part of the glaucoma screening.

APPLICABLE HCPCS CODES

Use the following HCPCS codes to bill for glaucoma screening:

G0117 Glaucoma screening for high-risk patients furnished by an optometrist or

Ophthalmologist

G0118 Glaucoma screening for high-risk patients furnished under the direct supervision of an optometrist or ophthalmologist

FREQUENCY LIMITATIONS

Coverage for glaucoma screenings is only provided on an annual basis. Therefore, at least 11 months must pass following the month in which the last covered glaucoma screening examination was performed. Once a beneficiary has received a covered glaucoma screening procedure, the beneficiary may receive another procedure after 11 full months have passed. To determine the 11-month period, start your count beginning with the month after the month in which the previous covered screening procedure was performed.

DIAGNOSIS CODING REQUIREMENTS

Bill glaucoma screening using screening ICD-9 code V80.1 (Special Screening for Neurological, Eye and Ear Diseases, Glaucoma). Claims submitted without a screening diagnosis code may be returned to the provider as unprocessable.

PAYMENT/DEDUCTIBLE INFORMATION

Reimbursement for glaucoma screening will be made on the basis of the Medicare physician fee schedule. Deductible and coinsurance apply. Claims from physicians or other providers where assignment is not taken are subject to the Medicare limiting charge.

Medicare will pay for glaucoma screening examinations when they are furnished by or performed under the direct supervision in the office setting of an optometrist or ophthalmologist, legally authorized to perform the services under State law.

DOCUMENTATION

Medical record documentation must support that the beneficiary is a member of one of the high risk groups previously discussed. The documentation must also support that the appropriate screening (i.e., either a dilated eye examination with IOP measurement and a direct ophthalmoscopic examination or a slit-lamp biomicroscopic examination) was performed.

Glaucoma Screening And Medicare


Glaucoma represents a family of diseases commonly associated with optic nerve damage and visual field changes (a narrowing of the eyes’ usual scope of vision). It is the second leading cause of irreversible blindness in the United States.1 Of the various forms of glaucoma (such as congenital, angle-closure, and secondary), open-angle glaucoma is the most common.

Over 2.2 million Americans age 40 and over have open-angle glaucoma. Often progressing silently, it is estimated that up to one-half of Americans with glaucoma may not know they have the disease. Glaucoma occurs when increased fluid pressure in the eye presses against the optic nerve, causing damage. The damage to optic nerve fibers can cause blind spots to develop. These blind spots usually go undetected until the optic nerve is significantly damaged. If the entire optic nerve is destroyed, blindness results.4 Since glaucoma progresses with little or no warning signs or symptoms, and vision loss from glaucoma is irreversible, it is very important that people at high risk for the disease receive an annual screening. Studies have shown that the early detection and treatment of glaucoma, before it causes major vision loss, is the best way to control the disease.

The glaucoma screening covered by Medicare includes:
• A dilated eye examination with an intraocular pressure (IOP) measurement
AND
• A direct ophthalmoscopy examination or a slit-lamp biomicroscopic examination

Increased IOP is common with glaucoma. In the past, it was thought that an increased IOP measurement indicated glaucoma; however, an IOP measurement using non-contact tonometry (more commonly known as the “air puff test”) alone was commonly used to diagnose glaucoma. Health care professionals now know that glaucoma can be present with or without increased IOP, which makes the examination of the eye and optic nerve (along with the IOP measurement) a critical part of the glaucoma screening.

Risk Factors

Anyone can develop glaucoma. Some risk factors that may increase an individual’s chances of developing glaucoma include age, race, family history, and medical history. Medicare provides coverage of an annual glaucoma screening for beneficiaries in at least one of the following high risk groups:
• Individuals with diabetes mellitus
• Individuals with a family history of glaucoma
• African-Americans age 50 and over
• Hispanic-Americans age 65 and over


Because of the prevalence of glaucoma found in these groups, it is of special importance for these individuals to receive regular glaucoma screenings. According to the National Eye Institute (NEI), African-Americans between the ages of 45 – 64 are 15 times more likely to go blind from glaucoma than Caucasians from the same age group5 and the incidence of glaucoma increases with age. Adults with diabetes are nearly twice as likely to develop glaucoma as other adults, and the longer a person has had diabetes, the more likely he or she is to develop glaucoma.6
coverage information

Medicare coverage of glaucoma screening was implemented with the Benefits Improvement and Protection Act of 2000 (BIPA). This coverage took effect on January 1, 2002.

Medicare provides coverage for an annual glaucoma screening (i.e., at least 11 months have passed following the month in which the last Medicare-covered glaucoma screening examination was performed) for eligible beneficiaries in at least one of the high risk groups identified previously in this brochure.
Medicare will pay for glaucoma screening examinations when they are furnished by or performed under the direct supervision in the office setting of an optometrist or ophthalmologist, legally authorized to perform the services under State law.

NOTE: Medicare does not provide coverage for routine eye refractions.
Documentation

Medical record documentation must support that the beneficiary is a member of one of the high risk groups previously discussed. The documentation must also support that the appropriate screening (i.e., either a dilated eye examination with IOP measurement and a direct ophthalmoscopic examination OR a slit-lamp biomicroscopic examination) was performed.
ForMore Information
The Centers for Medicare & Medicaid Services (CMS) has developed a variety of educational resources as part of a broad outreach campaign to promote awareness and increase utilization of preventive services covered by Medicare.

Tuesday, June 16, 2009

Glaucoma usually comes without any warning

What is glaucoma?

Glaucoma is an eye disorder in which the fluid pressure inside the eye causes progressive damage to parts of the optic nerve. The pressure usually increases when there is inadequate drainage of fluid from inside the eye. A gradual but permanent loss of vision occurs unless the condition is treated.

Are there different types of glaucoma?

There are three main types:
1. Acute glaucoma – when a rapid blockage of the drainage system occurs. With little or no warning, the eye becomes red and very painful, and misty vision may cause halos around lights; 2. Chronic glaucoma – when the pressure slowly increases over several months of years. No symptoms are present in the early stages, and severe loss of vision may occur before a person realises that something is wrong;
3. Secondary glaucoma results when injury, inflammation, or tumour blocks the drainage canals.

How does glaucoma affect sight?

If the pressure is raised for a period of time, some fibres of the optic nerve which conduct impulses from light sensitive cells of the retina to the brain are destroyed. Because the loss of vision occurs slowly, and away from the direct line of clearest vision, a person with glaucoma may not notice any changes to their sight until a considerable reduction to the field of vision has occurred. Without treatment, this loss continues until the eye is blind.

How is glaucoma detected?

Your optometrist will check for glaucoma as part of a regular eye examination. Tests include assessing the appearance of the optic nerve head, measuring the pressure in the eye, and analysing the complete field of vision. If any signs of glaucoma are detected, you will be referred to an ophthalmologist (eye doctor) for further evaluation.

Can sight which is lost be regained?

No – treatment aims to prevent any further loss of vision. EARLY DIAGNOSIS IS ESSENTIAL – VISION ALREADY LOST CANNOT BE REGAINED.

Who gets glaucoma?

Anyone may develop glaucoma, but the risk increases as age increases, and the risk is higher if close relatives have glaucoma. About 2 in 100 people over the age of 40 have glaucoma.

Should vision be checked regularly?

Everyone, especially those over 40, should have their eyes examined regularly to check that no eye health problems are present of developing.

Have you had your vision checked recently?

A thorough optometric examination will ensure that you continue to have efficient, comfortable vision and healthy eyes. Don’t forget that most people begin to have difficulty with near vision in their forties. This is a normal ageing process solved by using spectacles to help with close work. Checks for glaucoma are part of a routine eye examination. These are particularly important for people over 40, or where there is a family history of glaucoma.

Guide to Glaucoma Lasers and Implants

Abbott Medical Optics Inc. c 1700 East St. Andrew Place c Santa Ana, CA 92705 c 714-247-8200 c www.amo-inc.com

Baerveldt
The design of Baerveldt glaucoma implants provides maximal surface areas for aqueous filtration and pressure relief. Baerveldt glaucoma implants are available in three models. Features include large surface area plates, single-quadrant insertion, patented bleb control mechanism, decreased bleb height, low edge height, smooth, tumble-polished, and pliable silicone material, four fenestrations to promote fibrous adhesion, open drainage tube, fixation suture holes.

Carl Zeiss Meditec c 5160 Hacienda Drive c Dublin, CA 94568 c 800-342-9821 c Fax: 925-557-4589 c www.meditec.zeiss.com

Visulas Trion multicolor photocoagulator Visulas Trion multicolor laser, the most advanced photocoagulation system to date. Delivering superior power and stability at yellow, green, and red wavelengths for reliable performance for even the busiest clinics. Featuring intuitive touch navigation and dual fiber ports for efficient workflow. For unparalleled treatment precision, the renowned Zeiss Laser Slit Lamp offers the joystick mounted micromanipulator and optional Accento eyepiece.

Visulas YAG III Combi The VisulasYAG III Combi is a fully integrated laser system with all the premium features associated with Zeiss. It includes an electronic micro-manip- ulator at the joystick for simultaneous guidance of laser and illumination, cornea protective optics and the high-visibility touch screen. It combines the finest optic and laser technologies, including the Zeiss Super-Gaussian YAG beam for minimized energy exposure.

Ellex c 7138 Shady Oak Road c Minneapolis, MN 55344 c 800-824-7444 c Fax: 952-941-5511 c www.ellex.com

Ellex Eye Cubed The Eye Cubed is the first high-resolution ultrasound to deliver a complete view of the anterior segment. Featuring real-time imaging, advanced movie mode using the fastest sampling rate available, and internal memory for storing measurements, The Eye Cubed advances the diagnostic process. Customized configuration of A-Scan and B-Scan modes make the device ideal for both retinal specialists and anterior segment surgeons.

Ellex Integre The Ellex Integre is the first solid-state green photocoagulator that incorporates the laser cavity and slit lamp in an efficient, self-contained design. Because the laser cavity and optical assembles are a fully integrated component of the system, the beam has a shorter distance to travel, delivering more stable energy. The Integre can perform laser trabeculoplasty and laser iridotomy in managing elevated IOP.

Ellex Integre Duo The Integre Duo is the first solid-state photocoagulator to deliver clinically proven red and green wavelengths. This advanced laser system makes it possible to instantly select either a red or green wavelength during treatment, which maximizes treatment options and ensures effective patient results. The Integre Duo can perform laser trabeculoplasty and laser iridotomy in green and suturelysis in red in managing elevated IOP.

Ellex Solitaire The Ellex Solitaire is a full-featured, solid-state green laser system that is portable and versatile for use in both operating rooms and clinics. Compact and efficient, it is designed for use with a wide variety of industry-standard delivery systems and accessories, and it can be used to perform laser trabeculoplasty and laser iridotomy in managing elevated IOP associated with glaucoma.

Ellex Super Q The Ellex Super Q YAG laser provides precise and reliable treatments for anterior eye disease. The Super Q is designed for easy transport between multiple sites and combines comprehensive safety features with a firing rate of up to 2 Hz. It provides an effective treatment option for closed-angle glaucoma patients.

Ellex Ultra Q The Ellex Ultra Q is the ophthalmic industry’s premier capsulotomy and iridotomy YAG laser. With a firing rate of up to 3 Hz, it is the industry’s fastest photodisruptor. The Ultra Q features a custom-designed laser cavity, as well as a fine, two-point focusing system to provide a high level of precision when treating closed-angle glaucoma patients with iridotomy.

Endo Optiks c 39 Sycamore Ave. c Little Silver, NJ 07739 c 732-530-6762 c Fax: 732-530-5344 c www. endooptiks.com

E2 Laser and Endoscopy System The E2 laser and endoscopy system combines video imaging, illumination and laser delivery through a patented, triple function, autoclavable, 20 gauge laser microendoscope. Endoscopic cyclophotocoagulation is an elegant technique allowing the ciliary process to be easily viewed and titrated for long-term IOP reduction in the treatment of medically controlled glaucoma.

IOP Inc. c 3184-B Airway Ave. c Costa Mesa, CA 92626 c 714-549-1185 c Fax: 714-549-0557 c www.iopinc.com

Molteno3
The new Molteno3 is the latest tube shunt option based on several decades of experience with drainage device technology utilized earlier in the therapeutic path. The low profile single quadrant design simplifies insertion. The unique design feature includes a pressure ridge designed to stage bleb development producing double plate performance with single quadrant simplicity.

Iridex c 1212 Terra Bella Ave. c Mountain View, CA 94043 c 800-388-4747 c Fax: 650-962-0486 c www.iridex.com

IQ 810
The IQ 810 laser system is a multi-functional laser for glaucoma, retina and general ophthalmic use. Unique MicroPulse settings allow fine control of laser exposure, limiting thermal transfer to exposed tissue. Using MicroPulse for laser trabeculoplasty (MLT) allows treatment without scarring and burning associated with ALT. Adding the G-Probe for transscleral CPC, the IQ 810 is truly a comprehensive laser system.

Lumenis c 5302 Betsy Ross Drive c Santa Clara, CA 95054 c 877-586-3647 c Fax: 408-764-3500 c www.ophthalmic.lumenis.com

Aura PT
The Aura PT is the essential laser for performing disruption of the capsule or posterior capsulotomy. An intuitive laser with comprehensive set of features and compact design. Highlights include ±500 μm offset, a 2.5 Hz rep rate and 5 3 optics.

Selecta II
Proven to reduce IOP without adverse effects; a lightweight, portable Q-Switched frequency-doubled solid-state 532 nm laser with 3 nanosecond pulse duration confines thermal damage to selectively targeted pigmented cells, without creating collateral damage to surrounding tissue. Selecta II - LaserLink adapts to a convergent optics slit lamp with tonometer post.

Selecta Duet The Lumenis Selecta Duet represents the industry’s most advanced anterior-segment laser, combining the advantages of YAG photodisruption capabili- ties along with the innovative selective laser trabeculoplasty (SLT) technology, which was developed and brought to market by Lumenis. An integrated design combines superior optics with an advanced laser cavity make the Duet one of the best performing laser products in this segment.

Selecta Trio The Lumenis Selecta Trio represents the next generation of multi-modality products, offering retinal, cataract and advanced glaucoma therapies in a single platform. The Selecta Trio has all of the advantages of the Selecta Duet in SLT and YAG modes — along with proprietary advantages in photocoagulation mode — offering maximum flexibility with minimum footprint.

New World Medical Inc. c 10763 Edison Court c Rancho Cucamonga, CA 91730 c 909-466-4304 c Fax: 909-466-4305 c www.ahmedvalve.com

Ahmed Glaucoma Valve New World Medical Inc., an innovative biomedical company, manufactures and distributes the Ahmed Glaucoma Valve: the most effective and precise glaucoma drainage device. The Ahmed Glaucoma Valve, as well as accessory products, enables New World Medical Inc. to lead the way in advanced glaucoma drainage technology. Visit us at www.ahmedvalve.com or call customer service at 800-832-5327.

Nidek c 47651 Westinghouse Drive c Fremont, CA 94539 c 800-223-9044 c Fax: 510-226-5750 c www.usa.nidek.com

Nidek Combination YAG/Green system The Nidek combination YAG/Green system is the best-selling combination system on the market. It offers the benefits of saving space and cost with the versatile combined unit. Nidek combination lasers feature all the benefits of individual lasers and more. The split prism illumination reduces laser lens reflection, and the YAG can be fired directly with no need to adjust the illumination.

Ocular Surgery NewS presents this guide to glaucoma lasers and implants as a service to our readers. All manufacturers were asked to supply information for this guide. Those who provided information are listed. All claims are those of the manufacturers and appear here as received from the manufacturers. A listing in this guide does not constitute an endorsement by the publisher or editors of Ocular Surgery NewS. We regret any omissions.

Monday, June 15, 2009

Antisense oligonucleotide for treatment of neovascular glaucoma

What is neovascular glaucoma?

Glaucoma refers to certain eye diseases that affect the nerve of the eye and can cause vision loss. Most of these diseases typically produce gradual increase of the pressure in the eye leading to the injury of the nerve. In neovascular glaucoma the normal drainage canals within the eye are physically blocked by growth of new vessels. Diabetes, too high blood pressure, an excess of cholesterol in the blood and the presence of elements obstructing some vessels, represent significant risk factors for the development of neovascular glaucoma.

The condition is chronically debilitating, in particular due to uncontrolled high pressure inside the eye and loss of vision.

What are the methods of treatment available?

At the time of submission of the application for orphan drug designation, the treatment of neovascular glaucoma consisted of various surgical procedures and authorised medicines. Satisfactory argumentation has been submitted by the sponsor to justify the assumption that their medicinal product might be of potential significant benefit for the treatment of neovascular glaucoma. The assumption will have to be confirmed at the time of marketing authorisation. This will be necessary to maintain the orphan status.

What is the estimated number of patients affected by the condition?

According to the information provided by the sponsor, neovascular glaucoma was considered to affect about 75,000 to 113,000 persons in the European Union. How is this medicinal product expected to act? The medicinal product is a very short fragment of genetic code (DNA), which specifically blocks the production of a protein directly involved in the vessel growth stimulation. Thus once administered on the eye the medicinal product is intended to locally prevent the growth of new blood vessels.

Whis the stage of development of this medicinal product?

The effects of antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) were evaluated in experimental models. At the time of submission of the application for orphan designation, no clinical trials in patients with neovascular glaucoma were initiated.

The medicinal product was not marketed anywhere worldwide for neovascular glaucoma or designated as orphan medicinal product elsewhere for this condition, at the time of submission. According to Regulation (EC) No 141/2000 of 16 December 1999, the Committee for Orphan Medicinal Products (COMP) adopted on 30 July 2003 a positive opinion recommending the grant of the above-mentioned designation.

Glaucoma Arrives On Managed Care’s Doorstep



For the first time, managed care organizations are attempting to understand ophthalmologic diseases, particularly glaucoma. Their interest is driven by the appearance in recent years of several new pharmaceutical products to treat glaucoma. These new pharmacotherapeutic classes, including the prostaglandins and alpha2 agonists, are improving quality of life for people with glaucoma — preserving vision and halting progression of the disease more effectively than older products. Their efficacy has created demand for them and, in turn, a need for appropriate criteria for their utilization.

It wasn’t always this way. For years, glaucoma floated beneath the radar screens of most MCOs. The reason? Until recently, glaucoma was not a cost center. Medical directors’ agendas tend to be shaped by cost and utilization drivers that affect the bottom line: pharmacy, injectables, office visits, hospitalization, and emergency care. Most pharmacy directors will acknowledge that they actively monitor utilization of only the top 10 classes of drugs, including antihistamines, antidepressants, and antihypertensives. Traditionally, ophthalmologic agents rarely made the top 20, meaning that pharmacy directors weren’t overly concerned about them being significant contributors to expenses.

All the while, glaucoma continued its insidious assault on more than 2 million people, particularly the elderly, black, and Hispanic populations (NEI 2002). The second-leading cause of blindness in the United States, glaucoma is primarily associated with elevated intraocular pressure (IOP).Over time, IOP damages the optic nerve — destroying, at first, peripheral and then central vision — often silently, going unnoticed until its late stages. IOP can be controlled with medication, and, as the Ocular Hypertension Treatment Study demonstrates, early detection and treatment can prevent or delay onset of primary open-angle glaucoma, the most common form of the disease (Kass 2002).Argon laser trabeculoplasty , which aids fluid drainage from the eye and thus reduces IOP, is generally indicated after medications have been tried. End-stage glaucoma is often treated with conventional surgery after medication and laser-treatment failures.

The turning point in treatment — and what gained the attention of health plans and their pharmacy and therapeutics committees — was the development of powerful new medication therapies. Specifically, two things occurred. First, the introduction of popular new prostaglandin and alpha2 agonist products abruptly brought about higher utilization, while their expense relative to older therapies produced a new cost driver in managed care organizations. Second, the recent appearance of competitive products within these drug classes offered patients, health plans, and physicians new treatment options. Suddenly, there were choices to be made. Health plans will need assistance in dealing with these formulary options.

Friday, June 12, 2009

Other types of glaucoma

If there is inflammation in the eye (anterior uveitis), adhesions may develop between the lens and iris (posterior synechiae). These adhesions will block the flow of aqueous between the posterior and anterior chambers and result in forward ballooning of the iris and a rise in the IOP. Adhesions may also develop between the iris and cornea (peripheral anterior synechiae), covering up the trabecular drainage meshwork.

Inflammatory cells may also block the meshwork. Topical steroids may cause a gradual asymptomatic rise in IOP that can lead to blindness. (Patients taking topical steroids over a long period should always be under ophthalmological supervision.) The growth of new vessels on the iris (rubeosis) occurs both in diabetic patients and after occlusion of the central retinal vein resulting from retinal ischaemia. These vessels also block the trabecular meshwork causing rubeotic glaucoma, which is extremely difficult to treat.

The trabecular meshwork itself may have developed abnormally (congenital glaucoma) or been damaged by trauma to the eye. Patients who have had eye injuries have a higher chance than normal of developing glaucoma later in life. If there is a bleed in the eye after trauma, the red cells may also block the trabecular meshwork.

The Scope of Ophthalmology

Although the eye and its surrounding structures would seem to provide an ideal anatomical and functional basis for specialisation, ophthalmology can no longer regard itself as a specialty on its own but more the heading for a group of subspecialties. There are those who know all about the pigment epithelium of the retina and yet bow to those who have a special knowledge of the bipolar cells in the retina. Over the past 100 years the science has advanced at an unbelievable rate and with the increase in our knowledge has come the development of treatments and cures, which have had a great impact on our everyday lives.

The importance of the eye and its function is sometimes underrated, but a consideration of the part played by vision in our consciousness makes us soon realise its value. If we think of dreams, memories, photographs and almost anything in our daily existence, it is difficult to express them without visual references. After a little careful consideration of the meaning of blindness, it is easy to sense the rational and irrational fears that our patients present to us in the clinic. Nevertheless, in a modern European community the effects of blindness are not so apparent as in former years, and blind people tapping their way about the street or begging for food are less in evidence to remind us of the deprivation that they suffer. This is due to the effective application of preventive medicine and the efficacy of modern surgical techniques.

However, in the western world we have a new and increasing problem related to the increasing number of elderly people in the population. The problem is that of sensory deprivation owing to degenerative disease. Degenerative changes in the eye are now a major cause of blindness and although support services are being developed there is still no effective cure.

The broad and detailed scientific interest in the eye and vision is witnessed by the large number of journals, conferences and meetings that now exist, possibly more than in any other specialty. There are several hundred ophthalmological journals all contributing to the scientific literature on the subject and many are now accessible through the internet or on CDROM. As an organ of clinical specialisation, the eye does have a special advantage; it can be seen. Using the slit-lamp microscope it is possible to examine living nerves, including nervous system tissues and blood vessels, in a manner that is not possible in other parts of the body without endoscopy or biopsy. So much are the component parts of the eye on display to the clinician that when a patient presents to a casualty department with symptoms, the explanation of the symptoms should be made evident by careful examination. Compare this with the vague aches and pains that present to the gastroenterologist or the neurologist, symptoms that might ultimately resolve without any cause being found for them. The student or newly qualified doctor must be warned that if the patient presents with eye symptoms and no abnormality can be found after examination, then he or she must look again, because it is likely that something has been missed.

Most of the work of the ophthalmologist is necessarily centred on the globe of the eye itself, and there are a number of conditions that are limited to this region without there being any apparent involvement of the rest of the body. Ophthalmology is usually classified as a surgical specialty but it provides a bridge between surgery and medicine. Most of the surgery is performed under the microscope and here the application of engineering principles in the design of finer and finer instruments has played an important part. There is overlap with the fields of the plastic surgeons and the neurosurgeons. On the medical side, the ophthalmologist has links with the physicians and particularly the diabetic specialists and cardiologists, not to mention paediatricians and dermatologists.

Wednesday, June 10, 2009

Causes of gradual visual loss

Refractive errors

The pinhole test is a most useful test for identifying refractive errors. If there is a refractive error, the vision will improve when the pinhole is used. A patient with thick glasses should wear them for the pinhole test. Once other causes of visual loss have been excluded, the patient can be sent to an optometrist for refraction and correction of refractive error (for example, glasses).

Corneal disease

Various disorders can cause gradual loss of the corneal endothelial cells and increasing oedema of the cornea (for example, Fuch's endothelial dystrophy). This leads to a gradual decrease in visual acuity that does not improve substantially with a pinhole. If the damage is advanced the cornea may appear opaque. A corneal graft from a donor may be required.

Cataract

This is probably the most common cause of gradual visual loss. It can be diagnosed through testing the red reflex. The patient should be referred if the visual disturbance interferes appreciably with their lifestyle. If a patient with a cataract cannot project light or has an afferent pupillary defect, however, other diseases such as a retinal detachment must be excluded.

Primary open angle glaucoma

Unfortunately, the patient may not complain of visual disturbance until late in the course of the disease; hence the need for screening. Primary open angle glaucoma should, however, be excluded in any patient complaining of gradual visual loss. Establish whether there is any family history of glaucoma. The vision may still be 6/6, so the visual field should be checked with a red pin. Also check for cupping of, or asymmetry between, the optic discs.

Age-related macular degeneration

This may occur gradually and is typified by loss of the central field. There are usually pigmentary changes at the macula. The disease occurs in both eyes, but it may be asymmetrical, and it is more common in shortsighted people. The gradual deterioration is not treatable, but if acute visual distortion develops this may indicate a leaking area under the retina (choroidal neovascularisation), which may respond to laser photocoagulation or photodynamic therapy.

Macular hole

A macular hole is a full thickness absence of neural tissue at the centre of the macula. Between 10 and 20% of full thickness macular holes (FTMH) will become bilateral. Patients usually present with painless loss of central vision or distortion of the central visual field, although early macular holes may be asymptomatic. Patients with established FTMH can be treated with vitrectomy and instillation of intraocular gas (to provide retinal tamponade), which have a high chance of closing the hole successfully.

Diabetic maculopathy

Diabetic retinopathy occurs in both insulin dependent and non-insulin dependent diabetics and affects all age groups. The patient may or may not give a history of diabetes, although the longer the duration of the diabetes, the more likely the patient is to have retinopathy. Remember that although the patient may describe the onset of visual loss as gradual, sight threatening diabetic retinopathy may still be present. Non-proliferative diabetic retinopathy is typified by microaneurysms, dot haemorrhages, and hard yellow exudates with well defined edges. There also may be oedema of the macula, which is less easily identified but can lead to a fall in visual acuity. Non-proliferative diabetic retinopathy at the macula (diabetic maculopathy) is the major cause of blindness in maturity onset (type 2) diabetes, but it also occurs in younger, insulin dependent (type 1) diabetic patients. Some forms of diabetic maculopathy may be amenable to focal laser photocoagulation. Proliferative retinopathy, typified by the presence of new vessels, requires urgent referral for treatment.

Hereditary degeneration of the retina

These conditions are relatively rare (for example, retinitis pigmentosa) but should be suspected if there is a family history of visual deterioration. Symptoms include night blindness and intolerance to light. Most types of retinal degeneration are not yet treatable, but some are associated with metabolic disorders that can be treated. These patients need to be referred to an ophthalmologist, preferably with a special interest in these conditions, for diagnosis and any possible treatments. Patients with severe visual impairment may develop visual hallucinations and sleep disturbance. It is particularly important for these patients to have an opportunity to discuss their diagnosis and prognosis and to have genetic counselling. Patients can be helped through psychosocial counselling (see below, Management of gradual visual loss).

Compressive lesions of the optic pathways


These are relatively rare, but should always be considered. Clues in the history and examination include headaches, focal neurological signs, or endocrinological abnormalities such as acromegaly. There should not be an afferent pupillary defect in most patients with cataract, macular degeneration, or refractive error. Therefore if an afferent defect is seen, suspect a compressive or other lesion of the optic pathways. Testing of the visual fields may show a bitemporal field defect due to a pituitary tumour. The optic discs should be checked for optic atrophy and papilloedema.

Drugs


Several drugs may cause gradual visual loss. In particular, a history of excessive alcohol intake or smoking; methanol ingestion; or the taking of chloroquine, hydroxychloroquine, isoniazid, thioridazine, isotretinoin, tetracycline, or ethambutol should lead to the suspicion of drug induced visual deterioration. Systemic, inhaled, or topical corticosteroids may cause cataracts and glaucoma.

Tuesday, June 9, 2009

The Symptoms,Risks and Sings of Primary Open Angle Glaucoma

Primary open angle glaucoma

Primary open angle glaucoma is the most common form of glaucoma and is the third most common cause of registration of blindness in the United Kingdom. The resistance to outflow through the trabecular meshwork gradually increases, for reasons not fully understood, and the pressure in the eye slowly increases, causing damage to the nerve. The level of IOP is the major risk factor for visual loss. There may be other damage mechanisms, particularly ischaemia of the optic nerve head.

Symptoms

Because the visual loss is gradual, patients do not usually present until severe damage has occurred. The disease can be detected by screening high risk groups for the signs of glaucoma. At present most patients with primary open angle glaucoma are detected by optometrists at routine examinations.

Groups at risk

The prevalence increases with age from 0.02% in the 40-49 age group to 10% in those aged over 80. Those with an increased risk include first degree relatives of patients (1 in 10), patients with ocular hypertension (particularly those with thin corneas, larger cup to disc ratios and higher IOPs), people with myopia, and people of African-Caribbean origin (X5 risk in Caucasians). Recently, genetic mutations have been identified that account for 3-4% of primary open angle glaucomas.

Signs

The eye is white and on superficial examination looks normal. The best signs for the purpose of detection are the optic disc changes. The cup to disc ratio increases as the nerve fibres atrophy. Asymmetry of disc cupping is also important, as the disease often is more advanced in one eye than the other. Haemorrhages on the optic disc are a poor prognostic sign. Longer term changes in disc cupping are best detected by serial photography, and the more recently introduced scanning laser ophthalmoscope may be able to detect structural changes in the nerve at an early stage of the disease.

Visual field loss is difficult to pick up clinically without specialised equipment until considerable damage (loss of up to 50% of the nerve fibres) has occurred. Computerised field testing equipment may detect nerve fibre damage earlier, particularly if certain types of stimuli such as fine motion or blue on yellow targets are used. Computer assisted field testing is also the best method for detecting long term change and deterioration of visual fields.

The classical signs of glaucoma (field loss and optic disc cupping) often are seen in patients who have pressures lower than the statistical upper limit of normal (21 mm Hg).

However, many clinicians now feel that these two glaucomas are part of the same spectrum of pressure dependent optic neuropathies, although these patients are sometimes referred to as having normal tension glaucoma. For an accurate measurement of IOP, intraocular pressure phasing, taking multiple measurements throughout the day is useful, so that any spikes can be detected.

Surgical treatment for glaucoma

Surgery was traditionally used only when treatment had failed to halt the progress of glaucoma, but there is some evidence that earlier surgical intervention is beneficial for selected patients.

Iridectomy

Peripheral iridectomy is performed in cases of angle closure glaucoma, both in the affected eye and prophylactically in the other eye. Most of these cases can be treated with the Nd-YAG laser. Surgery is reserved for difficult or refractory cases.

Drainage surgery

When it is not possible to achieve the target IOP with medical (or laser) therapy in glaucoma, then the next line of management is surgical. The most effective glaucoma filtration procedure is trabeculectomy. In this procedure a guarded channel is created, which allows aqueous to flow from the anterior chamber inside the eye into the sub-Tenon's and subconjunctival space (bypassing the blocked trabecular meshwork). A drainage "bleb" (aqueous under the conjunctiva and Tenon's capsule) can often be seen under the upper lid. Conjunctivitis in a patient with a drainage bleb should always be treated promptly, as there is an increased risk of the infection entering the eye (endophthalmitis).

Possible complications

The main cause of surgical failure is postoperative scarring of the drainage channel and drainage bleb. Scarring can be reduced by using adjuvant antiscarring therapy. Various antiscarring agents are used, including drugs used in anticancer therapy. These are delivered by short applications during surgery to the drainage bed on a sponge or by postoperative injections. The most commonly used drugs are 5-fluorouracil and mitomycin-c.

Glaucoma filtration procedures do carry some risk and the patient should be advised of the risk of postoperative cataract and hypotony (low pressure) and the possibility of a reduction in postoperative best corrected visual acuity.

Although trabeculectomy remains the gold standard glaucoma filtration procedure, several alternative filtration operations also exist. Non-penetrating deep sclerectomy and viscocanalostomy have good safety profiles but have tended to produce less dramatic reductions in IOP in all published trials.

For certain patients with refractory glaucoma, a tube drainage device may be considered. A drainage tube is inserted, connecting the anterior chamber of the eye with a reservoir in the posterior orbit. This has a good chance of controlling IOP, but also has moderately high risk of serious complications.

Laser treatment for angle closure glaucoma

Laser trabeculoplasty
Argon or diode laser "burns" are applied to the trabecular meshwork. How this treatment works is uncertain. It was thought to contract one part of the meshwork, so stretching and opening up adjacent areas, but a more recent hypothesis is that it rejuvenates the cells in the trabecular meshwork. This treatment is used only in the types of glaucoma where the drainage angle is open. Its effect is relatively short term, so this treatment is mainly used for more elderly patients.

Laser iridotomy

Peripheral laser iridotomy (PI) can be performed in cases of angle closure glaucoma with the Nd-YAG laser, which (unlike argon or diode lasers) actually cuts holes in tissue rather than just burning. This procedure can be performed without incising the eye.

Laser iridoplasty

Argon laser iridoplasty is a useful procedure in some forms of angle closure glaucoma. A ring of laser burns is applied to the peripheral iris, causing contraction of tissue. This pulls the peripheral iris away from the drainage angle and helps to reduce angle occlusion.

Laser ciliary body ablation

Lasers can be used to burn the circular ciliary body that produces the aqueous humour. At the correct wavelength the laser radiation passes through the white sclera and is only absorbed by the pigmented ciliary body (transcleral ciliary body cycloablation). This treatment is now commonly performed with a diode laser and usually has to be repeated to maintain lowering of IOP. Most patients undergoing laser ciliary body ablation need to continue medical therapy. Laser destruction of the ciliary body usually is used only in advanced refractory glaucomas or where other surgical options are limited.

Monday, June 8, 2009

Medical treatment in glaucoma management

The main aim of therapy in glaucoma management is reduction of IOP. There is now good evidence from multiple large randomised trials that reducing IOP is effective in preventing disease progression in ocular hypertension, primary open angle glaucoma, and even in so-called normal tension glaucoma. Target pressures in the low teens are associated with the lowest progression rates.

βblockers ( for example, timolol, levobunolol, carteolol, betaxolol, and metipranolol)

These reduce the secretion of aqueous and are still the most commonly prescribed topical treatment. Contraindications to their use include a history of lung or heart disease, as the drops may cause systemic β blockade. It is important to be aware that topical βblockers can unmask latent and previously undiagnosed chronic obstructive airway disease in elderly people. Systemic effects from eye drops can be reduced by occlusion of the punctum (finger pressed on the caruncle, which can be felt as a lump at the inner canthus of the eye) or shutting the eyes for several minutes after putting in the drops.
This reduces the lacrimal pumping mechanism and stops the eyedrops running down the lacrimal passages and being absorbed systemically via the nasal mucosa or by inhalation directly into the lungs. This may also enhance ocular absorption of the drugs. These drops are usually given twice a day, but long acting forms now available can be given once a day, either alone or in combination with other drops.

Prostaglandin analogues ( for example, latanoprost, travoprost, and bimatoprost)

These reduce the IOP by increasing aqueous outflow from the eye via an alternative drainage route called the uveoscleral pathway. It is possible to get reductions in IOP of up to 30–35% with these drugs. This ability to achieve larger reductions in IOP with improved systemic safety profiles has been a major therapeutic advance in glaucoma. Systemic side effects are minimal but an unusual side effect in a few patients with light irides is a gradual, permanent darkening of the iris. Patients often notice that their eyelashes increase in length and darken. For optimum effect, these drops are used once daily (at night).

Sympathomimetic agents

Topical adrenaline, once commonly prescribed, is now rarely used because of lack of efficacy compared with βblockers and adverse effects on the conjunctiva. A newer generation of agents that stimulate the  receptors of the sympathetic system is now used—for example, brimonidine (used twice a day) or apraclonidine. Contraindications include cardiovascular disease, because of the potential systemic sympathomimetic effects.

Parasympathomimetic agents ( for example, pilocarpine)

These constrict the pupil and “pull” on the trabecular meshwork, increasing the flow of the aqueous out of the eye. The small pupil may, however, cause visual problems if central lens opacities are present. Constriction of the ciliary body causes accommodation and blurred vision in young patients. Pilocarpine should not be used if there is inflammation in the eye, as the pupil may stick to the lens close to the visual axis (posterior synechiae) and affect vision. Pilocarpine is usually administered four times a day but can be used twice daily in a combined form with a βblocker, or once at night in a gel preparation, which reduces side effects. When patients first instill pilocarpine they often experience a marked brow ache, which tends to reduce with longer term use of the drug.

Pilocarpine therapy can increase the risk of retinal detachment. Carbonic anhydrase inhibitors These are available as topical (for example, dorzolamide, brinzolamide) or oral (for example, acetazolamide) agents. They reduce the secretion of aqueous, and the systemic form, administered orally, is the most powerful agent for reducing IOP, although unfortunately it may have side effects, including nausea, lassitude, paraesthesiae, electrolyte disturbances, and renal stones. The topical form has minimal systemic side effects. Carbonic anhydrase inhibitors should not be used in patients with sulphonamide allergy.

Neuroprotective agents

Experimental evidence exists that some neuroprotective agents may reduce intraocular pressure induced glaucomatous damage. However, at present there is no conclusive evidence that these agents are helpful in glaucoma, but large scale clinical trials are currently being carried out in this area.

Allergy to glaucoma drops

The main symptoms of drop allergy are intense itching and irritation of the eyes and eyelids, which are exacerbated by instillation of the drops. The characteristic signs of drop hypersensitivity include red injected eyes, red swollen eyelids, and ezcema like excoriation of the eyelids and periocular skin.

The patient may be hypersensitive to the active glaucoma drug or one of the preservative agents used to stabilise the preparation (usually benzalkonium chloride).

The diagnostic test for drop hypersensitivity is controlled cessation of therapy. Symptoms and signs should rapidly improve on withdrawal of the topical therapy. When patients are on multiple topical agents it can be difficult to isolate the agent responsible for the allergic reaction. In cases of allergy to the preservative agent in the drugs, some topical drugs used in glaucoma management are available in preservative free form.

Symptoms and clinical signs of glaucoma

A patient with primary open angle glaucoma (also known as chronic open angle glaucoma) may not notice any symptoms until severe visual damage has occurred. This is because the rise in intraocular pressure and consequent damage occurs so slowly that the patient has time to compensate. In contrast, the clinical presentation of acute angle closure glaucoma is well known, as the intraocular pressure rises rapidly and results in a red, painful eye with disturbance of vision.

Raised intraocular pressure

Most patients with raised intraocular pressure (IOP) are unaware that they have a problem. Raised IOP is detected most commonly through screening as part of a routine eye test by an optometrist. The IOP is determined by the balance between aqueous production inside the eye and aqueous drainage out of the eye through the trabecular meshwork. Each normal eye makes about 2 l of aqueous a minute¡ªthat is, about 70 litres during the course of a lifetime. In a British Caucasian population, 95% of people have an IOP between 10 and 21 mm Hg, but IOP can drop as low as 0 mm Hg in hypotony and can exceed 70 mm Hg in some glaucomas.

The rate at which raised IOP causes optic nerve damage depends on many factors, including the level of IOP and whether glaucomatous damage is early or advanced. In general, raised IOPs in the 20-30 mm Hg range usually cause damage over several years, but very high IOPs in the 40-50mm Hg range can cause rapid visual loss and also precipitate retinovascular occlusion.

Haloes around lights and a cloudy cornea

The cornea is kept transparent by the continuous removal of fluid by the endothelial cells. If the pressure rises slowly, this process takes longer to fail. When the pressure rises quickly (acute closed angle glaucoma) the cornea becomes waterlogged, causing a fall in visual acuity and creating haloes around lights (like looking at a light through frosted glass).

Pain

If the rise in pressure is slow, pain is not a feature of glaucoma until the pressure is extremely high. Pain is not characteristically a feature of primary open angle glaucoma.

Visual field loss

Pressure on the nerve fibres and chronic ischaemia at the optic nerve head cause damage to the retinal nerve fibres and usually results in characteristic patterns of field loss (arcuate scotoma).

However, this spares central vision initially, and the patient does not notice the defect. Sophisticated visual field testing techniques are required to detect early visual field defects. The terminal stage of glaucomatous field loss is a severely contracted field, because only a few fibres from the more richly innervated macula area survive. Even at this stage (tunnel vision) the vision may still be 6/6.

Optic disc changes

The optic disc marks the exit point of the retinal nerve fibres from the eye. With a sustained rise in IOP the nerve fibres atrophy, leaving the characteristic sign of chronic glaucoma¡ªthe cupped, pale optic disc.

Venous occlusion

Raised IOP can impede blood flow in the low pressure venous system, increasing the risk of retinal venous occlusion.

Enlargement of the eye

In adults no significant enlargement of the eye is possible because growth has ceased. In a young child there may be enlargement of the eye (buphthalmos or ¡°ox-eye¡±). This tends to occur with raised IOP in children under the age of three years. These children may also be photophobic and have watering eyes and cloudy corneas.


Enlarged watering eyes
with cloudycorneas in a child with glaucoma

Nutritional Therapy For Eye Disorders

Inflammation

According to TCM:“Fire eye” (red and swollen eyes), often in spring and fall, caused by external wind–heat with repletion conditions in liver and gallbladder (allergy).
Very good results can be achieved by combining acupuncture, nutritional therapy, and herbal therapy.

Conjunctivitis
Wind–Heat


Symptoms
Itching and foreign-body sensation in eyes, red swollen eyes, headache, aversion to wind.

Tongue: Reddened sides; thin yellow fur

Pulse: Fast


Causes

External wind–heat and draft during spring or fall that irritate the eyes; wind–heat in the lung pathway,often in combination with heat conditions in liver and gallbladder.

Therapy

  • Expel external wind–heat
  • Clear heat
  • Calm liver

Thermal
nature Cool and cold

Organ network Liver, gallbladder

Flavor Bitter, sour, salty, possibly a little sweet

Preparation Raw, boiled, steamed
methods



To expel wind–heat:
  • Vegetables Chinese (napa) cabbage,dandelion, tomatoes

To cool heat:
  • Vegetables Cucumbers, mung beans,spinach, tomatoes, water chestnuts
  • Beverages Gentian tea, green tea,wheat beer
  • Spices Chinese chrysanthemum blossoms, peppermint

Tips
Increase consumption of green tea,mixture of tomato juice and melon juice, Chinese chrysanthemum
blossom tea.

Sunday, June 7, 2009

17-POINT CHECKLIST FOR GLAUCOMA

If you know you have glaucoma:

1. Seek encouragement from family, friends and other sources, such as glaucoma patient support groups.

2. You’ll be visiting your eye doctor regularly, so choose one with whom you are comfortable.

3. Write down your questions and notes so that you can make the most of your eye doctor appointments.

4. Tell your eye doctor, family and friends how medications are affecting you.

5. Tell all of your doctors about your eye medications and other drugs you’re taking.

6. Read materials from accurate sources to help you understand and live with glaucoma.

7. Ask your doctor to write down your medication schedule. Ask whether “four times a day” means “every six hours” or while you’re awake.

8. Always use the proper procedure for applying glaucoma medication in eye drop form.

Know the following risk factors and ask yourself these questions: (9-15 put you at higher risk for glaucoma)

9. Did my parents, grandparents or great-grandparents lose their sight? What was the cause of their vision loss? Glaucoma occurs at least twice as frequently among people who have blood relatives with glaucoma.

10. Do I have diabetes?

11. Am I of African-American or of Afro-Caribbean descent? (if so, you are more likely to get glaucoma younger.)

12. Am I 40 years of age or older?

13. Have I had an eye injury or eye surgery, even as a child?

14. Am I very nearsighted?

15. Have I taken steroids on a long-term basis?

16. Do I qualify for the annual glaucoma screening benefit under Medicare?

17. Most importantly: Have I had an eye exam recently?

Visit your eye doctor regularly

If you are 55 or older, you should get an eye exam at least once every two years. If you have diabetes or other health problems, you may need to see an eye doctor more often.

During a dilated eye exam, the eye doctor widens the pupil of the eye with eye drops to allow a closer look at the inside of the eye. The exam is not painful, and it may not always be part of an eye exam for a new pair of eyeglasses or contact lenses. A dilated eye exam will allow your eye doctor to check for glaucoma and other eye diseases.

FACTS ABOUT WORLD GLAUCOMA DAY

Who Created World Glaucoma Day?

• World Glaucoma Day is a joint initiative,of the World Glaucoma Association (WGA) and the World Glaucoma Patient Association (WGPA), spearheaded by the WGA/WGPA Physician Liaison Committee

When is World Glaucoma Day?

• The first World Glaucoma Day is March 6, 2008, and it will take place annually in March

Why was World Glaucoma Day Created?

• World Glaucoma Day was developed in response to the concern over the worldwide increase in the number of people with glaucoma and the resulting increase in the number of people who could go blind from this disease as the population increases and ages, if they do not have the condition detected and treated.

• Most glaucoma patients do not know they have the condition – it is also known as “the sneak thief of sight” or the “silent blinding disease” as it causes patient-noticeable symptoms only late in its progress, when a significant part of the “vision capital” has been irretrievably lost. In developed countries 50% of glaucoma patients are not diagnosed and are not on treatment; in developing countries, up to 95% of patients have not been detected, and are not receiving therapy.

• Glaucoma damage to sight is irreversible, but treatment is usually effective in preventing further damage, so the earlier in the course of the disease effective treatment is commenced, the more sight can be preserved.

What is World Glaucoma Day?

• World Glaucoma Day aims to educate people about how to assess their risk for glaucoma and to be aware of the importance of regular eye exams and disease detection.

• World Glaucoma Day also seeks to provide support for diagnosed patients and for members of the advocacy community.

• Multiple events are taking place globally

Where does it take place?

• World Glaucoma Day will be marked worldwide, raising awareness of glaucoma for thousands of members of the public, healthcare professionals, government officials and the media.

• Members of the WGPA and other glaucoma advocacy groups are also organizing numerous local and national events.

What events are organized, and where? • You can find a list of all organized events in the World Glaucoma Day website, at www.wgday.net. You will also find other material (like multilingual World Glaucoma Day logos, posters, news releases, etc, as well as ideas for local events to be organized.

What can I do to help?

• Anyone can organize a local event. It is only required to register the event online (at www.wgday.net). You can also join an event that is organized near you, (like an educational conference, a glaucoma screening day, etc)

About the World Glaucoma Association and World Glaucoma Patient Association

Both the WGA and WGPA were created to minimize visual disability from glaucoma, and to better the lives of glaucoma patients around the world. The WGA works to optimize the quality of glaucoma science and care through communication and cooperation among national and regional Glaucoma Societies, with companies involved with glaucoma, glaucoma patient organizations and many others in the glaucoma community. The WGPA works globally to encourage the establishment of and cooperation among national Glaucoma Patient Associations worldwide. The group serves as an umbrella organization to provide useful information to individuals, health care providers and support groups that are devoted to the fight against glaucoma.

Saturday, June 6, 2009

Sleep apnea tied to glaucoma, other eye disorders

Researchers with the Mayo Clinic have found that sleep apnea could raise the chances of developing glaucoma and other eye conditions, as well as a range of cardiovascular disease and metabolic disorders.

More than 12 million people currently suffer from sleep apnea, a potentially dangerous condition in which breathing repeatedly stops and starts in the course of sleeping.

The most common form of the condition is obstructive sleep apnea (OSA), which causes throat muscles to relax, blocking airways. The Mayo Clinic study found that people with longer and more frequent episodes of OSA were more likely to contract both primary open-angle glaucoma and normal-tension glaucoma. OSA was also tied to higher risk of obesity, diabetes and high blood pressure. The study’s lead author, E. Andrew Waller, M.D., noted that eyes can often signal larger vascular problems. He added that understanding the linkages between sleep apnea and vision loss could be important to early diagnosis and treatment.

“For patients with OSA, a routine eye examination to evaluate for early signs of glaucoma, particularly in the setting of visual loss or change, should be recommended. Patients with ophthalmologic diseases known to be associated with sleep apnea should be screened clinically for sleep apnea and referred to a sleep center if signs or symptoms are present.”

Some frequently asked questions about glaucoma

  • Q: What is childhood glaucoma and how can I prevent the disease from progressing?

A: Childhood glaucoma, also known as infantile or congenital glaucoma, is a disease of infants and is sometimes inherited. It involves a developmental abnormality of the trabecular meshwork, which is the drainage tissue of the eye. Treatment options include medications to lower intraocular pressure and/or anterior chamber angle surgery. Some patients may also need other types of glaucoma surgery. The goal of treatment is to lower the intraocular pressure to prevent permanent visual loss. It is also important to monitor the visual function and to treat any delay in the affected eye’s visual development.


  • Q: I have been given a variety of eye drops in a failed attempt to control elevated eye pressure that was apparently caused by retinal vein occlusion in my left eye. I had many problems with the eye drops, including a terribly upset stomach, nausea, indigestion, heartburn and gas. My doctor changed my prescription to Xalatan and Timolol. I have noticed that the pupil in my left eye has become significantly larger than the pupil in my right eye, which is not being treated. Can Timolol cause this symptom and is it safe to continue to use it?

A: Timolol is a topical beta-blocker that acts to reduce intraocular pressure and is very commonly prescribed for the treatment of glaucoma. Timolol has not been shown to cause pupillary dilation. The size of your left pupil may be related to the prior retinal vein occlusion. Other causes of pupillary dilation include topical medications, iris neovascularization, prior intraocular surgery, and others. Your eye doctor should be able to determine the cause of your pupillary asymmetry.

  • Q: Is it true that glaucoma patients cannot take medications like Actifed or Sudafed for relief of cold symptoms because they can cause a dangerous increase in eye pressure?

A: Cold medicines such as Actifed and Sudafed can cause mild pupil dilation, which can affect eye pressure. Patients with very narrow angles or untreated angle-closure should not take cold medications. Patients who have been treated for narrow-angle glaucoma or open-angle glaucoma can take cold medicines safely. Your eye care provider should be able to advise you as to the safety of this medication class in your particular case.

  • Q: My husband is 36 years old and was just diagnosed with early-stage glaucoma in his left eye. There is no history in his family. Why did he develop this condition and will he be OK? He is now being treated with eye drops. Can you help me?

A: Primary open-angle glaucoma is a multifactorial disease that can affect patients in their 30s. Some patients have no family history of the disease. Glaucoma that affects only one eye may be related to other conditions such as trauma and pseudoexfoliation. Glaucoma that is detected in the early stages carries a better prognosis than glaucoma that is diagnosed at an advanced stage. Treatment involves reduction of the intraocular pressure and monitoring of the optic nerve function. With diligent treatment and follow-up, your husband should maintain vision throughout his lifetime.

Friday, June 5, 2009

Questions about particular symptoms

Some specific questions are important in certain circumstances. A history of ocular trauma or any high velocity injury— particularly a hammer and chisel injury—should suggest an intraocular foreign body. Other questions, for example about the type of discharge in a patient with a red eye, may enable you to make the diagnosis.

  • Previous ocular history


Easily forgotten, but essential. The patient’s red eye may be associated with complications of contact lens wear—for example, allergy or a corneal abrasion or ulcer. A history of severe shortsightedness (myopia) considerably increases the risk of retinal detachment. A history of longsightedness (hypermetropia) and typically the use of reading glasses before the age of 40 increases the risk of angle closure glaucoma. Patients often forget to mention eye drops and eye operations if they are asked just about “drugs and operations.” A purulent conjunctivitis requires much more urgent attention if the patient has previously had glaucoma drainage surgery, because of the risk of infection entering the eye.

  • Medical history


Many systemic disorders affect the eye, and the medical history may give clues to the cause of the problem; for instance, diabetes mellitus in a patient with a vitreous haemorrhage or sarcoidosis in a patient with uveitis.

  • Family history

A good example of the importance of the family history is in primary open angle glaucoma. This may be asymptomatic until severe visual damage has occurred. The risk of the disease may be as high as 1 in 10 in first degree relatives, and the disease may be arrested if treated at an early stage. For any disease that has a genetic component (for example, glaucoma), the age of onset and the severity of disease in affected family members can be very useful information.
  • Drug history

Many drugs affect the eye, and they should always be considered as a cause of ocular problems; for example, chloroquine may affect the retina. Steroid drugs in many different forms (drops, ointments, tablets, and inhalers) may all lead to steroid induced glaucoma.

An accurate history and examination before iagnosis and treatment

As in all clinical medicine, an accurate history and examination are essential for correct diagnosis and treatment. Most ocular conditions can be diagnosed with a good history and simple examination techniques. Conversely, the failure to take a history and perform a simple examination can lead to conditions being missed that pose a threat to sight, or even to life.

The history may give many clues to the diagnosis. Visual symptoms are particularly important.

The rate of onset of visual symptoms gives an indication of the cause. A sudden deterioration in vision tends to be vascular in origin, whereas a gradual onset suggests a cause such as cataract. The loss of visual field may be characteristic, such as the central field loss of macular degeneration. Symptoms such as flashing lights may indicate traction on the retina and impending retinal detachment. Difficulties with work, reading, watching television, and managing in the house should be identified. It is particularly important to assess the effect of the visual disability on the patient’s lifestyle, especially as conditions such as cataracts can, with modern techniques, be operated on at an early stage.

The patient should also be asked exactly what is worrying them, as visual symptoms often cause great anxiety. Appropriate reassurance then can be given.

Success rates for incisional glaucoma surgery

Success rates for incisional glaucoma surgery depend on patient factors as discussed earlier, but are also affected by surgical techniques. The use of antimetabolites has significantly improved both the success rate and the survival rate of trabeculectomies. Two typesof antimetabolites are commonly used in glaucoma surgery. 5-Fluorouracil (5-FU) inhibits DNA replication but is reversible and may be used intraoperatively, as well as multiple times postoperatively. Mitomycin-C permanently binds DNA, and can only be used once with maximal effect after~5 min.

The Fluorouracil Filtering Surgery Study examined the success rates of trabeculectomies with and without the use of postoperative 5-FU. Success was defined as IOP ,21 mmHg with or without medications and no need for re-operation to control IOP. The 5 years success rate of trabeculectomies was 49% with 5-FU use, but only 26% without antimetabolite use (Fig. 1.1) (27). One of the major causes of failure in both groups was early postoperative wound leak (within 2 weeks of surgery). At 5 years, the success rate for the 5-FU group was 54% in eyes without a leak and 28% in those with a leak. The 5 year success rate in the group without antimetabolites was 24% without a wound leak and 15% with a leak (28). Risk factors for wound leaks include the use of antimetabolites, one-layer (vs. two-layer) conjunctiva-Tenon capsule closure, inferiorly located trabeculectomy, and older patients.

More recent studies have demonstrated similar efficacy with intraoperative mitomycin-C without the need for postoperative injections of antimetabolites (29). With the use of any antimetabolite, caution must be exercised as these patients may be more susceptible to complications from glaucoma surgery such as wound leaks or blebrelated infections

The decision to proceed with glaucoma surgery is usually straightforward: surgery is indicated when target pressures are not achieved or when optic disc and/or visual field loss occurs despite maximally tolerated medical and laser therapies. However, risk factors for progression other than IOP must be evaluated as well. The presence of numerous risk factors in addition to IOP suggests the need for more aggressive target pressures and treatment. Early surgery may be indicated when compliance with medical therapy is a problem, or in developing countries where the cost of medications may be prohibitive. Large diurnal pressure variations in a patient with severe disc damage may also be an indication for earlier surgery even if the mean IOP is at target. Conversely, quality of life issues should not be used in the decision to either proceed with or delay with surgery. Once the decision to proceed with surgery has been made, careful pre-operative evaluation must be performed to determine the optimal site and type of glaucoma surgery, including the use of antifibroblastic agents. This will help to improve the success of the surgery and minimize potential complications.

Thursday, June 4, 2009

Several factors to be considered during glaucoma surgical planning.

Once the decision to proceed with glaucoma surgery has been made, several factors should be considered during surgical planning.
1. Patient Age
Younger patients tend to have a more vigorous healing response making them more susceptible to failure. This may indicate the use of antifibrotic agents, although they should be used with caution in young myopes due to the risk of hypotonous maculopathy. By the virtue of their longer life expectancy, younger patients are more likely to have surgical failure within their lifetimes, requiring repeat surgery. We therefore advise initial surgery in one upper quadrant leaving the other quadrant for repeat surgery at a later date. It is important to remember that surgery in younger patients may result in an increased risk of blebitis and endophthalmitis due to their longer life expectancy. Older patients may have a decreased healing response and may be more susceptible to complications in the short-term. In addition, elderly patients may have difficulty with postoperative care without assistance from caregivers.
2. External Disease
Evidence of ocular surface disease, including dry eye, conjunctival scarring, symblepharon, and previous ocular surgery, should be noted. These conditions make the surgical procedure more difficult, and also increase the risk of postoperative scarring, and complications. Lack of suitable conjunctiva may require an alteration in both the type and the site of surgery planned (e.g., from a trabeculectomy to a seton).
The lids should always be examined for epiphora, entropion, or distachiasis. These should be dealt with prior to glaucoma surgery. Temporary measures, such as Quickert sutures for entropion or epilation for distachiasis, may be sufficient. Chronic infections, such as staphylococcal blepharitis or purulent discharge from the lacrimal sac, must be addressed prior to glaucoma surgery.
3. General Health Status
Although most glaucoma surgery is performed with local anesthetic, including topical anesthetic, general health status should be known. In particular, patients with cardiovascular disease, systemic hypertension and diabetes are at increased risk of suprachoroidal hemorrhage. Surgery should be performed with caution in such cases. Patients with liver dysfunction or patients on anticoagulation therapy will have increased intraoperative bleeding. Such patients should be advised of the increased risk and be assessed by the relevant specialists before recommending discontinuation of anticoagulation therapy. Most glaucoma surgery can be successfully performed with patients on anticoagulation therapy but informed consent is important in such cases.

The Case for Early Surgery

Early surgical intervention has been advocated by the European glaucoma community. This approach was initially supported by a study from Scotland that compared initial medical therapy with initial surgical therapy for newly diagnosed POAG (25). In this study, 116 patients were randomized to either trabeculectomy at diagnosis or initial medical therapy followed by trabeculectomy in unsuccessful cases. No difference in visual acuity was detected, but greater visual field loss was found in patients with initial medical therapy. The investigators suggested that this was due to delay of surgery, whereas medical therapy was modified in patients with minimal visual field loss at diagnosis.

The Moorfields Primary Treatment Trial also evaluated medical therapy vs. surgical therapy for the primary treatment of glaucoma. This study randomized 48 patients to initial surgery and 40 patients to initial medical therapy. Surgery as primary treatment resulted in a lower mean IOP than medicine as primary treatment, although the visual fields were not statistically different (26). The investigators suggested that initial surgery is a safe and more cost-effective method for treating glaucoma.

CIGTS evaluated initial medical therapy vs. initial surgical therapy for the primary treatment of glaucoma (6,16). In that study, the surgical group achieved a lower average IOP than the medical group, but there was no statistically significant difference in the visual field scores between the two groups. As well, the medical treatment group had a better average visual acuity than the surgical group, and was less likely to have a clinically substantial visual loss (15 letters or more). This was partially due to the surgical group having a cataract extraction rate almost three times higher than the medical group. However, the difference remained even after adjusting for cataracts. The investigators speculated that the differences in the results of this study compared with the European studies might be related to having patients with glaucoma earlier in the disease course, as well as the availability of newer, more effective medical treatments. They did not suggest changing current treatment protocols based on their 5 year results indicating that longer-term studies were required for a chronic diseases such as glaucoma.


These studies suggest that both medical and surgical therapies as initial treatment for glaucoma are effective and safe. In general, surgery results in a slightly lower IOP than medical treatment alone. However, the importance of this additional IOP lowering in early glaucoma must be considered in relation to potential complications and effect on central vision. Since the potential for vision threatening complications is real, we feel surgical treatment should still be reserved for second- or third-line therapy until conclusive evidence becomes available to show that surgical treatment of glaucoma results in better visual function outcomes. The exception to this rule is in developing countries, where early surgical intervention is often indicated. With limited health care resources, there is often limited access to long-term follow-up care. In addition, life-long medical treatment is commonly prohibitively expensive for the patient. Under these circumstances, primary surgical treatment for glaucoma is a cost-effective solution despite the increased potential for complications (14,15).

Impact of medical and surgical therapies on patient quality of life

Both medical and surgical therapies have an impact on patient quality of life. Multiple medical therapy presents problems for elderly patients who often have difficulty in instilling drops, whereas, younger, active patients often have difficulty in maintaining a schedule for their medications. Surgical therapy often results in fewer medications in 6 Sit and Trope the long-term, but requires intense patient participation in the postoperative period. Complications of surgery can also affect patient quality of life.

In the CIGTS, quality of life factors was evaluated between initial medical and initial surgical therapies (16). Symptoms and vision specific factors were evaluated at baseline, 2 months and 6 months postrandomization, and then at 6 month intervals. Visual function symptoms included evaluation of glare disability, light/dark adaptation, acuity/spatial vision, visual search, visual processing speed, depth perception, color discrimination, and peripheral vision. The results indicated lower IOP in the surgical group (14– 15 mmHg) vs. the medical group (17–18 mmHg) but visual field progression was not statistically different between the two groups. Patients in the surgical group reported being bothered by more visual function symptoms than the medical group. Systemic and local eye symptoms were also evaluated. No consistent differences were found in systemic symptoms. The most persistent differences were in the local eye symptoms, which were reported more frequently in the surgical group. However, differences in symptoms between the treatment groups did not result in differences in broader measures of quality of life. Therefore, unless further information to the contrary arises, quality of life should not be used as a major factor in the decision to postpone or proceed with glaucoma surgery.

Compliance with glaucoma medications

Compliance with glaucoma medications, as with medications for any type of chronic diseases, is a major risk factor for progression. In the study by Kass et al. (12) using an eyedrop medication monitor, compliance with pilocarpine was found to be very poor. Fifteen percent of patients administered less than one-half of the prescribed doses.

Twenty-five percent of patients missed at least 1 day per month. When interviewed, however, patients reported taking an average of 97% of prescribed doses. In general, compliance with medications decreases with the frequency of dosing and the number of medications. However, even with newer medical therapies with less frequent dosing, compliance continues to be very poor (13). This is further exacerbated by the fact that glaucoma is an asymptomatic disease until the very late stages, and therapy does not result in any subjective improvement in their condition. Other major reasons for noncompliance include medication side effects (both local and systemic) and difficulty administering the medication.

In a patient where target IOP cannot be achieved consistently due to noncompliance, surgery must be seriously considered but only after patient education has been tried. The majority of the reasons sited by patients for noncompliance is not related to social or environmental factors and may be amenable to patient education or modification of medications (13). These include regimen factors (e.g., cost, complexity and side effects), patient factors (lack of knowledge/skill, forgetfulness, lack of motivation, and complexities created by co-morbidities), and medical provider factors (e.g., dissatisfaction with care and lack of communication).

Some situational compliance factors may be difficult to remedy. Patients who live in parts of the world where drops are not available or are prohibitively expensive, or live alone and have difficulty in administering the drops for physical reasons require earlier glaucoma surgery in order to achieve target pressures (14,15). However, caution must be exercised since good compliance with medications is required postoperatively in order to reduce potential surgical complications and enhance the chance of successful surgery.

To proceed with glaucoma surgery must include an evaluation of risk factors

The decision to proceed with glaucoma surgery must include an evaluation of risk factors other than IOP alone. Table 1.1 lists the risk factors for glaucoma progression other than IOP that were found in the major recent randomized controlled trials of glaucoma treatment. In addition, factors that were assessed and found to be noncontributory,and factors that were found to be protective are listed. All of these factors should be considered prior to proceeding to surgery.


Normal-tension glaucoma appears to have different risk factors than other types of glaucoma (5). Among the studies of elevated-pressure glaucoma, age is the only factor identified universally. Note that none of the studies found family history to be a significant factor for progression, and only the Collaborative Initial Glaucoma Treatment Study (CIGTS) identified race as a factor (6). This is likely a result of the high prevalence of the disease, but seems to contradict population surveys that clearly show race and family history to be associated with the presence of glaucoma. Race is clearly an important


factor may be more useful in glaucoma that occurs at a younger age. Central corneal thickness may also be an important independent risk factor for progression (8). Advanced disease is generally considered to be more susceptible to further glaucomatous damage than early disease. This is supported by the EMGT (9), CIGTS (6), and OHTS (10), which examined early glaucoma and ocular hypertension. However, the opposite result was found with AGIS (11) which examined advanced glaucoma and found that patients with better baseline visual fields were more likely to demonstrate progression. The investigators suggested that this might be due to greater difficulty in detecting visual field changes in advanced disease when compared with early disease.